Description of problem
Newcastle disease (ND) is a highly contagious viral disease that significantly threatens the poultry industry and global economies. It is caused by virulent strains of NDV, which belong to the genus Avulavirus, family Paramyxoviridae, and order Mononegavirales (Ogali et al., 2018). NDV is classified into five pathotypes based on virulence and clinical symptoms: viscerotropic velogenic, a highly pathogenic form characterized by hemorrhagic intestinal lesions; neurotropic velogenic, which presents with high mortality following respiratory and nervous signs; mesogenic, involving respiratory signs and occasional nervous symptoms with low mortality; lentogenic, typically resulting in mild or subclinical respiratory infections; and subclinical, characterized by enteric infections without overt symptoms (OIE, 2008). NDV is a non-segmented, single-stranded, negative-sense RNA virus that encodes six structural proteins: matrix (M), fusion (F), phosphoprotein (PP), nucleocapsid (N), and hemagglutinin-neuraminidase (HN) (Toyoda et al., 1987). On a genetic basis, NDV is divided into Class I and Class II viruses based on the fusion (F) protein; Class I has a single genotype, but class II viruses are divided into twenty genotypes (I–XIV and XVI–XXI) (Dimitrov et al., 2019). NDV induces oxidative stress in the brain and liver of chickens by suppressing their natural antioxidant defenses, thereby impairing their ability to neutralize reactive oxygen species (Subbaiah et al., 2015).
Vaccination is central to ND control, employing live attenuated and inactivated vaccines to reduce clinical signs and mortality. However, limitations such as incomplete prevention of viral shedding, antigenic variation, and stress-induced immunosuppression in commercial settings often hinder vaccine efficacy (Fawzy et al., 2021).
The strict biosecurity program is the first defense against viral infection, followed by the proper health status of the birds and the immune system functions. The immune response initiated by the vaccine effectively protects birds against viral-induced clinical signs and death. However, it does not entirely prevent infection, replication, or shedding of virulent viruses (Sedeik et al., 2019). Consequently, including natural immunomodulatory feed additives plays a critical role in the health conditions of poultry flocks (Selgas et al., 1993). As a growth promotor, the herbal extract benefits the poultry industry by enhancing health conditions and feed efficiency (Alagawany and Abd El-Hack, 2020). Interest in natural immunomodulators like LO and GO is growing to complement vaccination by boosting immune responses and reducing oxidative stress, potentially improving flock resilience and antibiotic dependency (Awad et al., 2023).
Lemongrass oil (LO) and geranium oil (GO) are promising as natural feed additives in poultry production due to their bioactive properties that enhance immunity, reduce oxidative stress, and support gut health. LO, derived from Cymbopogon citratus, contains antioxidant and antibacterial compounds such as limonene, α-citral, and β-citral, contributing to improved growth performance and feed efficiency in broilers (Al‐Sagheer et al., 2018; Alagawany et al., 2021)). Additionally, its ability to neutralize free radicals helps counteract viral-induced oxidative damage (Elegbeleye et al., 2022).
GO, extracted from Pelargonium graveolens, is rich in geraniol, citronellol, and linalool, which exhibit antimicrobial and immunomodulatory effects (Lis‐Balchin and Deans, 1996). In poultry, GO supplementation reduces oxidative damage, regulates cytokine responses, and lowers inflammation, enhancing disease resistance and overall flock health (Srivastava et al., 2024; Wani et al., 2021). LO and GO may serve as dual-action agents by enhancing immune defenses and mitigating infection-induced damage. Their potential as natural alternatives to synthetic feed additives aligns with global efforts to reduce antibiotic dependency in poultry farming (Alagawany et al., 2021).
LO and GO offer immunomodulatory and antioxidant benefits in poultry, but their effects on NDV replication remain underexplored. Their bioactive compounds may also influence cellular conditions affecting viral replication. This study explores the novel application of LO and GO as natural feed additives with potential immunomodulatory, antioxidant, and antiviral properties in NDV-challenged broiler chickens, comparing vaccinated and non-vaccinated groups.
Materials and methods
Ethical approval
The Institutional Animal Care and Use Committee (IACUC) of the Faculty of Veterinary Medicine, Alexandria University, Egypt, approved the study under Permit #2022/015/11. All procedures involving live birds adhered to the National Institutes of Health (NIH) Guidelines for the Care and Use of Laboratory Animals, ensuring compliance with international ethical standards. Measures were implemented to minimize animal suffering, including the use of humane handling techniques, appropriate environmental enrichment, and the application of anesthesia for euthanasia to prevent distress during sampling or experimental interventions. The approved protocol outlined all necessary steps to ensure the welfare of the experimental animals, further demonstrating the commitment to maintaining ethical standards throughout the study.
Lemongrass and geranium oil
LO and GO were obtained from Pure Essential Oils and Herbs CO., Kom Abou Radi Industrial Zone, Elwasta, Bani Swaif, Egypt. The samples were analyzed for phenolic, flavonoids, and chemical composition.
Gas Chromatography-Mass Spectrometry (GC-MS) analysis
The chemical composition of LO and GO was analyzed using a GC-TSQ mass spectrometer (Thermo Scientific, Austin, TX, USA) with a TG-5MS capillary column. The operational parameters followed standard protocols, and components were identified by comparing mass spectra with WILEY 09 and NIST14 databases (Lv et al., 2015)
High-performance liquid chromatography with ultraviolet detection (HPLC-UV)
LO and GO’s flavonoid and phenolic contents were analyzed using an Agilent Series 1100 HPLC-UV system with a C18 column. Phenolic acids and flavonoids were separated using gradient and isocratic elution methods, respectively, and quantified based on peak area using external standards (Mradu et al., 2012)
Vaccination program and the challenge virus
To optimize the timing of vaccination and minimize interference from maternal antibodies, maternal antibody titers were measured in ten randomly selected one-day-old chickens. Based on these measurements, the vaccination schedule was determined. The vaccination schedule was designed to provide comprehensive protection against major poultry diseases. On Day 5, Combivac C® (NDV Clone strain + IBV H120 strain, Jordan Bio Industries Center, Jordan) was administered intraocularly at 0.03 mL per chick. On Day 9, Egyflu ND-3 in1® (inactivated trivalent vaccine containing H9N1, H5N1 Egy/PR8-5 strain, and La Sota strain, Harbin Weike Biotechnology Co., China) was given subcutaneously in the neck at 0.3 mL per chick. On Day 14, Avishield ND® (La Sota strain, Dechra Co., UK) was applied intraocularly at 0.03 mL per chick as a booster to reinforce immunity. Finally, on Day 16, Ornibur® (live intermediate-plus IBD vaccine, Bioveta Co., Czech Republic) was administered intraocularly at 0.03 mL per chick.
The challenge’s virulent NDV genotype VII (accession No. KM288609) came from the Central Laboratory for Evaluation of Veterinary Biologics (CLEVB), an Egyptian strain bank. The propagation and titration of NDV and the calculation of embryo infective dose50 (EID50) were performed according to the manual of the World Organization of Animal Health (OIE, 2018). The challenge of chickens was done by intramuscular injection with 0.5 ml/bird (0.25 mL containing 106 EID50 diluted with 0.25 ml PBS) on the 28th day of age in all experimental groups except the control group was injected with 0.5 ml PBS (Awad et al., 2023)
Broiler chickens and experimental protocol
The current study was authorized by Alexandria University’s institutional ethics committee in Egypt and carried out following the local experimental animal care committee’s requirements. The local hatchery provided 250 one-day-old cobb broiler chicks, which were kept on a commercial diet consisting of starter feed up until the fifteenth day, which contained 23 % total protein and metabolizable energy (ME) of 3005 kcal/kg diet; grower feed up to the thirtyth day, which contained 21 % total protein and 3078 kcal/kg diet ME; and finisher feed up to the conclusion of the experiment, which contained 18 % total protein and 3195 kcal/kg diet ME. All the birds had free access to water and food. On the first day, the chicks were kept at 32°C; the temperature was lowered linearly by 2°C every week. Ten of the 250 chicks were killed at one day old to test maternal immunity; the other chicks were divided into two experiments (vaccinated and non-vaccinated, with 120 chicks in each experiment).
In the non-vaccinated experiment, 120 chicks were randomly divided into eight groups (15 chicks per group, three replicates of five chicks each) and housed in disinfected metal cages. Groups included non-supplemented (G1: non-challenged, G2: challenged), prophylactic (G3: LO, G4: GO, G5: LO+GO, all provided 3 days/week from Day 1 until challenge), and therapeutic (G6: LO, G7: GO, G8: LO+GO, all provided 3 days post-challenge) treatments. Each treatment consisted of 15 % essential oil (LO, GO) at 1 ml/L drinking water (0.5 ml each for LO+GO), corresponding to 300 mg/kg feed. In the vaccinated experiment, another 120 chicks were assigned the same group structure and treatment protocol and housed separately in clean metal cages (Table 1). The dose of LO and GO was chosen according to Al‐Sagheer et al. (2018); (Alagawany et al., 2021; Ghanima et al., 2021).
Table 1. Experimental groups.
| Experiment | Group | Treatment | Challenge | Description |
|---|---|---|---|---|
| Non-Vaccinated | G1 | NO | NO | Non-supplemented, non-challenged |
| Non-Vaccinated | G2 | NO | YES | Non-supplemented, challenged |
| Non-Vaccinated | G3 | LO (Prophylactic) | YES | LO (1 ml/L), 3 days/week, from Day 1 to challenge |
| Non-Vaccinated | G4 | GO (Prophylactic) | YES | GO (1 ml/L), 3 days/week, from Day 1 to challenge |
| Non-Vaccinated | G5 | LO+GO (Prophylactic) | YES | Combination of LO (0.5 ml/L) and GO (0.5 ml/L), 3 days/week, from Day 1 |
| Non-Vaccinated | G6 | LO (Therapeutic) | YES | LO (1 ml/L), from 3 days post-challenge |
| Non-Vaccinated | G7 | GO (Therapeutic) | YES | GO (1 ml/L), from 3 days post-challenge |
| Non-Vaccinated | G8 | LO+GO (Therapeutic) | YES | Combination of LO (0.5 ml/L) and GO (0.5 ml/L), from 3 days post-challenge |
| Vaccinated | G1 | NO | NO | Non-supplemented, non-challenged |
| Vaccinated | G2 | NO | YES | Non-supplemented, challenged |
| Vaccinated | G3 | LO (Prophylactic) | YES | LO (1 ml/L), 3 days/week, from Day 1 to challenge |
| Vaccinated | G4 | GO (Prophylactic) | YES | GO (1 ml/L), 3 days/week, from Day 1 to challenge |
| Vaccinated | G5 | LO+GO (Prophylactic) | YES | Combination of LO (0.5 ml/L) and GO (0.5 ml/L), 3 days/week, from Day 1 |
| Vaccinated | G6 | LO (Therapeutic) | YES | LO (1 ml/L), from 3 days post-challenge |
| Vaccinated | G7 | GO (Therapeutic) | YES | GO (1 ml/L), from 3 days post-challenge |
| Vaccinated | G8 | LO+GO (Therapeutic) | YES | Combination of LO (0.5 ml/L) and GO (0.5 ml/L), from 3 days post-challenge |
Clinical signs and postmortem lesions
The birds in the experimental groups were monitored daily for seven days post-challenge for any clinical symptoms. The mortality rate was documented, and deceased birds were examined for postmortem (PM) lesions. According to Nahed et al. (2020), the frequency and severity of clinical symptoms and PM lesions were assessed, scored, and documented.
Blood and tissue sampling
We collected the blood samples from the wing veins of five birds per replicate on the 28th and 35th day of age (7th day post-challenge (pc)) from the surviving birds. The sera were obtained by centrifugation for 10 min at 1500 xg and stored in Eppendorf tubes at −20°C until use. The serum samples were utilized to test serological, liver, and kidney function. On the 35th day, the chickens were anesthetized and given anesthesia using an intraperitoneal injection of sodium pentobarbital at a dose of 40 mg/kg. Subsequently, euthanasia was performed by cervical dislocation following the euthanasia guidelines outlined by the American Veterinary Medical Association (Underwood and Anthony, 2020) and dissected to remove spleen tissue, which was washed with ice-cold PBS and stored at −80°C for further determination of gene expression and antioxidant/oxidant indices.
Immune Response against NDV
The hemagglutination inhibition (HI) test was performed in U-bottom microtiter plates using 4 HA units of NDV genotype VII antigens (MEVAC Co., Egypt, Batch No: 210530) to measure serum anti-NDV IgG concentrations. HI titers of 1/16 (2⁴) or higher were considered positive, following the (OIE, 2008) protocol.
Oxidant/antioxidant indices in spleen tissues
Total glutathione (tGSH) was measured by oxidizing reduced glutathione (GSH) with 5,5ˋ-dithiobis-(2-nitrobenzoic acid) (DTNB). This produced 5-thio-2-nitrobenzoic acid (TNB) and oxidized glutathione (GSSG). To regenerate GSH, which could react again, the GSSG was enzymatically reduced using glutathione reductase and nicotinamide adenine dinucleotide phosphate (NADPH). At 412 nm, the TNB production rate was measured and proportional to the total amount of GSH and GSSG in the sample. The same technique was used to measure total glutathione to assess GSSG; however, 2-vinyl pyridine was used to bind the reduced glutathione (Griffith, 1980). The sample was heated with thiobarbituric acid (TBA) at low pH to identify malondialdehyde (MDA) as a thiobarbituric acid reactive substance (TBARS). The resulting pink chromogen was then measured for maximal absorbance at 532 nm using the procedure described in (Draper and Hadley, 1990) method. The pink chromogen that results has a maximum absorbance of 532 nm. NRF2, or nuclear factor erythroid-2 related factor-2, was measured in chickens using an ELISA kit (CAT#: MBS024157, MyBioSource, Inc., San Diego, USA) using a quantitative sandwich ELISA. The procedure was changed to find the protein in the samples. The protein residues in the sample’s tyrosine and tryptophan combine with the alkaline copper phenol reagent to form a combination that gives rise to the hue. A variation in the procedure was used to ascertain the protein concentration in the samples. The tyrosine and tryptophan residues of the protein in the sample and the alkaline copper phenol reagent formed a compound that gave the color. The protein concentration in each sample was estimated by contrasting each sample with a standard curve made with chicken serum albumin.
Expression of IL-10 and IFN-γ mRNA in spleen tissue
The miRNeasy Mini Kit (Qiagen, Germany) was used to extract total RNAs from 100 g of spleen tissue, following the manufacturer’s instructions. A cDNA synthesis reaction was then performed using the TOPscript™ RT DryMIX (dT18/dN6 plus) kit (Enzynomics Co Ltd, Korea, CAT#: RT220), which involved incubation with 3 µl RNA at 25 °C for 10 min, followed by 42 °C for 60 min, and finally at 95 °C for 5 min to inactivate the reaction. Relative quantification of IL-10 and IFN-γexpression was carried out using ViPrime PLUS Taq qPCR Green Master Mix I (Vivantis Technologies, Malaysia, CAT#: QLMM12) and specific primer sets for each gene (Table 2). The reaction mixture, including cDNA and master mix to a volume of 20 µl, underwent PCR under the following conditions: an initial activation step at 95 °C for 5 min, denaturation at 94 °C /20 s, annealing at 55 °C /20 s, and extension at 70 °C/15 s for 45 cycles. To determine the relative quantification (RQ) of IL-10 and IFN-γ, the threshold cycles (Ct) values of the target genes were calculated and normalized to those of the reference gene (GAPDH) in the same sample using the ΔΔCt method (Livak and Schmittgen, 2001).
Table 2. Primer sets of IL-10, IFN-γ, and GAPDH (Reference gene).
| Gene | Accession No. | primer sequence | |
|---|---|---|---|
| IL-10 | NM001004414.2 | F | 5- CCACCTGCCTGCACTTCTCT-3 |
| R | 5- CCCCTTAAACTCATCCAGCAGT −3 | ||
| IFN-γ | NM205149.1 | F | 5 -CATGATTTATTATGGACATACTGC-3 |
| R | 5- GCTCAGTATGATCCTTTTCTC −3 | ||
| GAPDH | NM204305.1 | F | 5- AAGCGTGTTATCATCTCAGCTC −3 |
| R | 5- AATGCCAAAGTTGTATGGAT −3 | ||
Statistical analysis
The data were statistically analyzed using the SPSS software (IBM, 2017), and the findings were presented as means ± standard error. One-way analysis of variance (ANOVA) with Tukey’s multiple comparison tests (posthoc test) was used to compare the means of the treatment groups at a significance level of p ≤ 0.05
Results and discussion
Essential oil constituents by GC and HPLC analysis
The chemical composition of LO and GO, detailed in Tables S1 and S2, highlights their antiviral potential, which is attributed to their ability to inhibit viral replication, disrupt viral structure, and enhance immune responses (Kiełtyka-Dadasiewicz et al., 2024). Additionally, their antioxidant properties help reduce NDV-induced oxidative stress, supporting overall poultry health and lowering mortality rates (Li et al., 2024). Their antimicrobial and immunomodulatory effects contribute to maintaining gut health and reducing secondary infections (Boukhatem et al., 2013; Jirovetz et al., 2006). The bioactive properties of LO and GO contribute to reduced mortality and improved health outcomes in treated groups, as demonstrated by the findings presented in Tables S1 and S2
Clinical signs, post-mortem lesions, and mortality rate
Neither clinical signs nor mortality were observed in G1 in non-vaccinated or vaccinated experiments from the day of challenge until the 35th day. The broilers of G2 in the non-vaccinated experiment showed signs of depression, greenish watery diarrhea, rales, conjunctivitis, and anorexia, which appeared suddenly beginning from 2nd pc. The mortality rate reached 53.3 %, and the post-mortem lesions of dead chicks included proventriculus hemorrhage, congested trachea, and mottled enlarged spleen (Table 3). Unfortunately, the mortality rate was increased in the protected and post-challenge supplemented groups: G3 (66.6 %), G4 (60 %), G5 (73.3 %, G6 (66.6 %), G7 (73.3 %), and G8 (80 %) although the severity of clinical signs and PM lesions were less than those in G2 (Table 3). As expected, the broilers of G2 in the vaccinated experiment showed mild to moderate signs and PM lesions with a mortality rate of 13.3 % (Table 4). The protected and post-challenge supplemented groups showed fewer signs and PM lesions than G2 except for the mortality rate, which reaches 20 % in G6 and G8 (Table 4).
Table 3. The frequency and severity score of clinical signs and postmortem lesion post-challenge with virulent NDV genotype VII in non-vaccinated broiler chickens1.
| Item | Experimental groups2 | |||||||
|---|---|---|---|---|---|---|---|---|
| G1 | G2 | G3 | G4 | G5 | G6 | G7 | G8 | |
| Mortality% (dead/total) | 0 (0/15) | 53.3 (8/15) | 66.6 (10/15) | 60 (9/15) | 73.3 (11/15) | 66.6 (10/15) | 73.3 (11/15) | 80 (12/15) |
| Clinical signs | ||||||||
| Watery, greenish diarrhea | 0 (0/15) | 3 (14/15) | 2 (8/15) | 2 (9/15) | 2 (10/15) | 2 (10/15) | 2 (11/15) | 3 (12/15) |
| Conjunctivitis | 0 (0/15) | 2 (10/15) | 2 (9/15) | 2 (9/15) | 2 (11/15) | 2 (9/15) | 2 (10/15) | 2 (11/15) |
| Sneezing and rales | 0 (0/15) | 2 (9/15) | 2 (8/15) | 2 (10/15) | 2 (9/15) | 2 (8/15) | 2 (11/15) | 3 (12/15) |
| Depression | 0 (0/15) | 3 (13/15) | 2 (11/15) | 2 (10/15) | 2 (11/15) | 2 (9/15) | 2 (11/15) | 2 (11/15) |
| P. lesions3 | ||||||||
| Proventriculus hemorrhage | 0 (0/3) | 3 (8/8) | 2 (5/10) | 2 (6/9) | 2 (6/11) | 2 (6/10) | 2 (6/11) | 2 (8/12) |
| Tracheal congestion | 0 (0/3) | 3 (7/8) | 2 (4/10) | 2 (5/9) | 2 (5/11) | 2 (6/10) | 2 (6/11) | 2 (7/12) |
| Mottled enlarged spleen | 0 (0/3) | 3 (7/8) | 2 (4/10) | 2 (5/9) | 2 (6/11) | 2 (5/10) | 2 (6/11) | 2 (8/12) |
- 1
-
The clinical signs or the postmortem lesion score (positive birds/examined birds) was recorded as follows: 0: no; 1: mild; 2: moderate; and 3: severe signs or lesions.
- 2
-
G1; Control negative, G2; Control positive, G3; Preventive lemon grass oil, G4, Preventive geranium oil, G5; Preventive lemon grass and geranium oil, G6; Treated lemon grass oil, G7; Treated geranium oil, G8; Treated lemon grass and geranium oil.
- 3
-
Post-mortem lesions were performed on the dead and slaughtered birds in the control group.
Table 4. The frequency and severity score of clinical signs and postmortem lesion post-challenge with virulent NDV genotype VII in vaccinated broiler chickens1.
| Item | Experimental groups2 | |||||||
|---|---|---|---|---|---|---|---|---|
| G1 | G2 | G3 | G4 | G5 | G6 | G7 | G8 | |
| Mortality% (dead/total) | 0 (0/15) | 13.3 (2/15) | 0 (0/15) | 0 (0/15) | 13.3 (2/15) | 20 (3/15) | 0 (0/15) | 20 (3/15) |
| Clinical signs | ||||||||
| Watery, greenish diarrhea | 0 (0/15) | 2 (7/15) | 1 (6/15) | 1 (7/15) | 2 (8/15) | 2 (9/15) | 1 (6/15) | 2 (9/15) |
| Conjunctivitis | 0 (0/15) | 1 (6/15) | 1 (5/15) | 1 (5/15) | 1 (6/15) | 1 (7/15) | 1 (4/15) | 1 (8/15) |
| Sneezing and rales | 0 (0/15) | 1 (5/15) | 1 (4/15) | 1 (5/15) | 1 (6/15) | 1 (5/15) | 0 (0/15) | 1 (5/15) |
| Depression | 0 (0/15) | 1 (6/15) | 0 (0/15) | 0 (0/15) | 1 (4/15) | 1 (5/15) | 1 (3/15) | 1 (6/15) |
| P. lesions3 | ||||||||
| Proventriculus hemorrhage | 0 (0/3) | 1 (1/3) | 0 (0/3) | 0 (0/3) | 1 (1/3) | 1 (1/3) | 0 (0/3) | 1 (1/3) |
| Tracheal congestion | 0 (0/3) | 1 (1/3) | 0 (0/3) | 0 (0/3) | 1 (1/3) | 1 (1/3) | 0 (0/3) | 1 (1/3) |
| Mottled enlarged spleen | 0 (0/3) | 1 (1/3) | 0 (0/3) | 0 (0/3) | 1 (1/3) | 1 (1/3) | 0 (0/3) | 1 (1/3) |
- 1
-
The clinical signs or the postmortem lesion score (positive birds/examined birds) was recorded as follows: 0: no; 1: mild; 2: moderate; and 3: severe signs or lesions.
- 2
-
G1; Non-Vaccinated-Control, G2; Vaccinated-Control, G3; Non-vaccinated-LO-Prophylactic, G4, Non-vaccinated-GO-Prophylactic, G5; Non-vaccinated-LO+GO-Prophylactic, G6; Non-vaccinated-LO-Therapeutic, G7; Non-vaccinated-GO-Therapeutic, G8; Non-vaccinated-LO+GO-Therapeutic.
One potential explanation for the increased mortality is the influence of metabolic by-products of LO and GO on cellular pH, which may enhance NDV fusion and replication. This mechanism aligns with findings that endosomal acidification facilitates viral fusion and infectivity (Sánchez-Felipe et al., 2014). It is plausible that LO and GO alter intracellular conditions in ways that potentiate NDV replication, thereby exacerbating disease severity.
The immunomodulatory activity of LO may be linked to the activation and proliferation of lymphocytes or stimulation of macrophages and T-helper lymphocytes (Haque et al., 2018). Additionally, the antioxidant properties of lemongrass extracts have been shown to enhance immune function at low doses (50–150 mg/kg). In comparison, higher doses exceeding 300 mg/kg can induce toxicity and result in animal mortality (Haque et al., 2018). Although the doses used in this study did not exceed 300 mg/kg, these findings emphasize the importance of further investigation into the dosing and duration of LO and GO supplementation, particularly concerning their effects on cytokine expression, viral replication, and overall immune interactions.
Serum protein, liver, and kidney indices
The serum total protein, albumin, and globulin concentrations insignificantly differed among all experimental groups (p > 0.05) 7-day post-challenge in non-vaccinated (Table 5) and vaccinated (Table 6) broiler chickens. In non-vaccinated chicken broilers, the serum ALT level was significantly (p ≤ 0.05) increased alongside an insignificant increase of serum total bilirubin and AST concentrations in G2 compared to the control group, indicating a detrimental effect of NDV challenge on liver function. However, supplementation of lemongrass and geranium oil alone or in combination, prior or post-challenge, significantly improved ALT and insignificantly decreased serum total protein and AST levels as compared to G2, with more protection observed in the protected rather than post-challenge supplemented groups. The combination of both oils was better than each one used alone. In vaccinated broiler chickens, there was no significant change in serum total bilirubin among all experimental groups. However, a substantial increase in serum ALT and AST activities was observed in G2 compared to the control group. Also, using lemongrass and geranium oil alone or in combination attenuated ALT and AST serum activities comparable to G2. Regarding renal function, there was no significant difference in serum creatinine and uric acid levels among non-vaccinated experimental groups (Table 5). However, uric acid level was insignificantly increased in the protected and post-challenge supplemented groups compared to G2, indicating perhaps a damaging effect of oil on kidney functions. In vaccinated groups, serum creatinine level was significantly (p ≤ 0.05) increased in G2 compared to the control group and insignificantly decreased in the protected and post-challenge supplemented groups with LO or GO in contrast to G2 (Table 6). Furthermore, serum uric acid did not differ in all vaccinated experimental groups; however, the highest insignificant level was observed in the post-challenge supplemented groups of LO and GO (table 7). Initiation of lipid peroxidation causes cell membrane injuries in the liver and kidney, resulting in leakage of hepatic enzymes into serum. Induction of oxidative stress resulted in hepatocyte injury with higher serum AST and ALT activities (Du et al., 2020). Our result proved that LO and/or GO supplementation provided hepato-renal protection. The dietary supplementation of LO in the broiler ration significantly increased the serum protein and globulin concentrations (Alzawqari et al., 2016) while attenuating the serum hepatic enzymatic activities (Gibson et al., 2017) owing to the cytoprotective efficacy of LO phenolic components. Furthermore, Ghanima et al. (2021) reported a decline in serum creatinine, uric acid, urea, ALT, AST, and MDA in broiler chickens reared under high stocking density and fed a LO-supplemented diet. While LO and GO supplementation improved liver and kidney function markers (Table 5, Table 6) and enhanced antioxidant status (Table 7, Table 8), these benefits did not translate into reduced mortality in NDV-challenged birds. The MCA analysis illustrates distinct patterns in how various LO and GO treatments affect broilers’ blood parameters. Groups treated prophylactically (e.g., G5, combining LO and GO) show unique and separated clustering, indicating significant and potentially beneficial effects, particularly on parameters like ALT and AST. In contrast, therapeutic groups (e.g., G6, G7, G8) cluster closer together, reflecting similar but less distinct responses. The negative control (G1) and vaccinated control (G2) are differentiated, showcasing the baseline and vaccination effects, respectively. These findings highlight the superior impact of combining LO and GO prophylactically over therapeutic or single-oil treatments, suggesting a synergistic benefit in preventing adverse effects of NDV. This analysis reinforces the importance of timing and combination in optimizing the use of LO and GO for poultry health Figure S1 and Figure S2. The heatmap illustrates the correlations among various blood parameters measured in the LO and GO supplementation study. Strong positive correlations between total protein and globulin (0.98) indicate that these parameters likely respond similarly to treatments. Conversely, a negative correlation exists between albumin and globulin (−0.58), suggesting an inverse relationship between these protein components. ALT and AST show a moderate positive correlation (0.39), reflecting their shared role as liver function markers. The strongest correlations involve ALT and total bilirubin (0.79), highlighting a potential link between liver function and bilirubin metabolism. These relationships provide insight into how LO and GO influence systemic physiological responses, with liver-associated markers showing interdependence while protein metabolism markers reveal distinct, treatment-sensitive patterns. This analysis underscores the importance of examining interactions between parameters for a comprehensive understanding of the effects of the treatments (Figure S3).
Table 5. Preventive and therapeutic effect of LO and GO alone or in combination on blood parameters in non-vaccinated broilers challenged with NDV.
| Empty Cell | G1 | G2 | G3 | G4 | G5 | G6 | G7 | G8 |
|---|---|---|---|---|---|---|---|---|
| T. Protein (g/dl) | 3.13±0.11 | 2.98±0.24 | 3.20±0.09 | 2.75±0.08 | 3.10±0.21 | 2.97±0.15 | 3.19±0.12 | 3.36±0.16 |
| Albumin (g/dl) | 1.68±0.05 | 1.71±0.09 | 1.71±0.09 | 1.72±0.04 | 1.74±0.06 | 1.79±0.09 | 1.78±0.08 | 1.74±0.07 |
| Globulin (g/dl) | 1.45±0.12 | 1.27±0.15 | 1.48±0.09 | 1.03±0.08 | 1.36±0.17 | 1.18±0.21 | 1.42±0.14 | 1.62±0.16 |
| T. Bilirubin (mg/dl) | 0.82±0.05ab | 1.15±0.05a | 0.78±0.10b | 0.82±0.09ab | 0.77±0.03b | 0.93±0.06ab | 1.00±0.13ab | 0.87±0.07ab |
| ALT (U/L) | 23.80±2.99b | 35.20±2.96a | 15.60±0.81bc | 16.20±2.60bc | 13.80±1.02c | 36.20±2.40a | 20.60±1.69bc | 18.80±1.11bc |
| AST (U/L) | 247.6 ± 19.03b | 328.8 ± 19.18ab | 322.2 ± 24.91ab | 317.2 ± 15.45ab | 289.0 ± 21.14ab | 361.0 ± 11.48a | 348.0 ± 17.91a | 302.8 ± 23.08ab |
| Creatinine (mg/dl) | 1.26±0.13 | 1.44±0.07 | 1.21±0.15 | 1.39±0.06 | 1.22±0.07 | 1.49±0.08 | 1.38±0.02 | 1.12±0.17 |
| Uric Acid (mg/dl) | 6.52±0.75 | 6.26±0.53 | 6.88±0.22 | 6.76±0.36 | 6.14±0.31 | 7.00±0.36 | 6.92±0.33 | 6.80±0.92 |
Values are expressed as Means ± SE. a–b-c Mean values within the same row with different superscript letters are statistically significant at p ≤ 0.023 for total bilirubin, p ≤ 0.021 for ALT, and p ≤ 0.009 for AST. 2G1; Non-Vaccinated-Control, G2; Vaccinated-Control, G3; Non-vaccinated-LO-Prophylactic, G4, Non-vaccinated-GO-Prophylactic, G5; Non-vaccinated-LO+GO-Prophylactic, G6; Non-vaccinated-LO-Therapeutic, G7; Non-vaccinated-GO-Therapeutic, G8; Non-vaccinated-LO+GO-Therapeutic., ALT; Alanine aminotransferase, AST; Aspartate aminotransferase. One-way analysis of variance (ANOVA) with Tukey’s multiple comparison tests.
Table 6. Preventive and therapeutic effect of LO and GO alone or in combination on blood parameters in vaccinated broilers challenged with NDV.
| Empty Cell | G1 | G2 | G3 | G4 | G5 | G6 | G7 | G8 |
|---|---|---|---|---|---|---|---|---|
| T. Protein (g/dl) | 3.19±0.16 | 3.28±0.12 | 3.06±0.12 | 3.53±0.19 | 3.68±0.16 | 3.56±0.11 | 3.36±0.10 | 3.71±0.18 |
| Albumin (g/dl) | 1.74±0.04 | 1.70±0.02 | 1.76±0.05 | 1.68±0.06 | 1.71±0.03 | 1.70±0.04 | 1.70±0.02 | 1.66±0.04 |
| Globulin (g/dl) | 1.45±0.18 | 1.58±0.11 | 1.31±0.17 | 1.63±0.26 | 1.97±0.18 | 1.86±0.14 | 1.67±0.11 | 2.04±0.18 |
| T. Bilirubin (mg/dl) | 0.65±0.04 | 0.86±0.09 | 0.69±0.04 | 0.74±0.06 | 0.65±0.04 | 0.82±0.08 | 0.84±0.07 | 0.73±0.06 |
| ALT (U/L) | 11.80±0.80b | 18.20±0.86a | 17.60±1.03a | 14.20±0.73ab | 12.40±0.51b | 17.20±0.86a | 14.80±1.24ab | 14.40±1.57ab |
| AST (U/L) | 164.2 ± 9.10c | 298.4 ± 10.08a | 24.60±11.82b | 250.8 ± 13.91ab | 240.8 ± 10.81b | 290.2 ± 17.33ab | 271.2 ± 15.58ab | 262.8 ± 9.41ab |
| Creatinine (mg/dl) | 1.13±0.04b | 1.56±0.04a | 1.34±0.04ab | 1.29±0.04ab | 1.29±0.16ab | 1.32±0.05ab | 1.49±0.13ab | 1.24±0.09ab |
| Uric Acid (mg/dl) | 5.92±0.27 | 6.58±0.27 | 6.60±0.21 | 6.36±0.52 | 6.36±0.45 | 6.95±0.26 | 6.92±0.27 | 6.71±0.17 |
Values are expressed as Means ± SE. a–b-c Mean values within the same row with different superscript letters are statistically significant at p ≤ 0.032 for total protein, p ≤ 0.001 for ALT and AST, and p ≤ 0.039 for creatinine. 2G1; Non-Vaccinated-Control, G2; Vaccinated-Control, G3; Non-vaccinated-LO-Prophylactic, G4, Non-vaccinated-GO-Prophylactic, G5; Non-vaccinated-LO+GO-Prophylactic, G6; Non-vaccinated-LO-Therapeutic, G7; Non-vaccinated-GO-Therapeutic, G8; Non-vaccinated-LO+GO-Therapeutic., ALT; Alanine aminotransferase, AST; Aspartate aminotransferase. One-way analysis of variance (ANOVA) with Tukey’s multiple comparison tests.
Table 7. Preventive and therapeutic effect of LO and GO alone or in combination on spleen oxidative stress and antioxidant indices in non-vaccinated broilers challenged with NDV.
| Empty Cell | G1 | G2 | G3 | G4 | G5 | G6 | G7 | G8 |
|---|---|---|---|---|---|---|---|---|
| Total GSH (nmol/mg protein) | 57.63±2.07a | 40.37±2.62b | 50.67±3.00ab | 44.80±4.08ab | 52.33±1.62ab | 49.10±3.23ab | 47.43±3.43ab | 50.87±3.24ab |
| GSSG (nmol/mg protein) | 2.57±0.23c | 4.40±0.26a | 3.70±0.15ab | 3.80±0.15ab | 3.37±0.09bc | 3.83±0.18ab | 3.70±0.29ab | 3.53±0.12ab |
| Reduced GSH (nmol/mg protein) | 52.50±1.62a | 31.57±2.22c | 43.27±2.84abc | 37.20±3.78bc | 45.60±1.45ab | 41.43±2.88abc | 40.03±2.87abc | 43.80±3.01abc |
| GSH/GSSG ratio | 20.70±1.27a | 7.20±0.35d | 11.73±0.70bc | 9.73±0.61cd | 13.53±0.15b | 10.77±0.28bc | 10.83±0.20bc | 12.37±0.47bc |
| MDA (nmol/g tissue) | 2.48±0.16c | 4.96±0.24a | 4.13±0.25ab | 4.41±0.10ab | 3.70±0.22b | 4.63±0.18ab | 4.78±0.12a | 4.07±0.24ab |
| NRF2 (ng/ mg protein) | 0.57±0.03a | 0.30±0.02b | 0.61±0.02a | 0.58±0.04a | 0.68±0.02a | 0.57±0.04a | 0.58±0.02a | 0.63±0.01a |
Values are expressed as Means ± SE. a–b-c Mean values within the same row with different superscript letters are a statistically significant difference at p ≤ 0.035 for total GSH, p ≤ 0.001 for GSSG, p ≤ 0.003 for reduced GSH, p ≤ 0.001 for GSH/GSSG ratio, MDA, and NRF2. 2G1; Non-Vaccinated-Control, G2; Vaccinated-Control, G3; Non-vaccinated-LO-Prophylactic, G4, Non-vaccinated-GO-Prophylactic, G5; Non-vaccinated-LO+GO-Prophylactic, G6; Non-vaccinated-LO-Therapeutic, G7; Non-vaccinated-GO-Therapeutic, G8; Non-vaccinated-LO+GO-Therapeutic. GSH; glutathione, GSSG; oxidized glutathione, MDA; malondialdehyde, NRF2; Nuclear Factor Erythroid 2-Related Factor 2. One-way analysis of variance (ANOVA) with Tukey’s multiple comparison tests.
Table 8. Preventive and therapeutic effect of LO and GO alone or in combination on spleen oxidative stress and antioxidant indices in vaccinated broilers challenged with NDV.
| Empty Cell | G1 | G2 | G3 | G4 | G5 | G6 | G7 | G8 |
|---|---|---|---|---|---|---|---|---|
| Total GSH (nmol/mg protein) | 58.10±3.08 | 51.67±1.61 | 54.37±2.22 | 51.20±2.14 | 55.70±0.64 | 51.53±2.71 | 50.80±1.98 | 53.40±1.35 |
| GSSG (nmol/mg protein) | 2.27±0.18b | 3.03±0.18ab | 3.33±0.15a | 3.30±0.17a | 2.77±0.18ab | 3.47±0.12a | 3.47±0.19a | 3.07±0.15ab |
| Reduced GSH (nmol/mg protein) | 53.57±2.75a | 45.60±1.46ab | 47.70±1.93ab | 44.60±1.80ab | 50.17±0.30ab | 44.60±2.55ab | 43.87±1.60b | 47.27±1.06ab |
| GSH/GSSG ratio | 23.77±0.81a | 15.10±0.82c | 14.33±0.15c | 13.50±0.20c | 18.23±1.03b | 12.87±0.55c | 12.67±0.22c | 15.47±0.38bc |
| MDA (nmol/g tissue) | 2.27±0.09c | 3.68±0.25a | 3.03±0.08abc | 3.30±0.06ab | 2.69±0.23bc | 3.45±0.07ab | 3.64±0.11a | 2.96±0.23abc |
| NRF2 (ng/ mg protein) | 0.82±0.04a | 0.57±0.03b | 0.84±0.02a | 0.82±0.02a | 0.90±0.03a | 0.80±0.03a | 0.77±0.03a | 0.82±0.03a |
Values are expressed as Means ± SE. a–b-c Mean values within the same row with different superscript letters are a statistically significant difference at p ≤ 0.735 for total GSH, p ≤ 0.001 for GSSG, p ≤ 0.024 for reduced GSH, p ≤ 0.001 for GSH/GSSG ratio, MDA, and NRF2. 2G1; Non-Vaccinated-Control, G2; Vaccinated-Control, G3; Non-vaccinated-LO-Prophylactic, G4, Non-vaccinated-GO-Prophylactic, G5; Non-vaccinated-LO+GO-Prophylactic, G6; Non-vaccinated-LO-Therapeutic, G7; Non-vaccinated-GO-Therapeutic, G8; Non-vaccinated-LO+GO-Therapeutic. GSH; glutathione, GSSG; oxidized glutathione, MDA; malondialdehyde, NRF2; Nuclear Factor Erythroid 2-Related Factor 2. One-way analysis of variance (ANOVA) with Tukey’s multiple comparison tests.
Oxidant and antioxidant indices in spleen tissue
In non-vaccinated broiler chickens, the concentrations of total glutathione, reduced GSH, Nrf2, and GSH/GSSG ratio in the spleen tissue of G2 were significantly (p ≤ 0.05) decreased subsequently with increased GSSG and MDA levels as compared to control group suggesting the effect of NDV on perturbation of oxidant and antioxidant status of broilers. However, using LO and GO alone or in combination as protected or post-challenge supplemented measures insignificantly (p > 0.05) increased tissue total GSH, reduced GSH, Nrf2, and GSH/GSSG ratio alongside decreasing tissue GSSG and MDA concentrations with the best improvement observed in combination groups indicating the antioxidant activity of these essential oils (Table 7). in the vaccinated groups, there was no significant difference in the total GSH among all groups however, the challenged untreated group (G2) showed significant lower reduced GSH, Nrf2 concentrations, and GSH/GSSG ratio subsequently with higher GSSG and MDA levels compared to control group. Moreover, the protected and post-challenge supplemented with LO and GO insignificantly improved the oxidant/antioxidant status during the NDV challenge (Table 8). Herin, the NDV challenge induced oxidative stress by elevating the MDA level with a decline in the Nrf2 and glutathione contents, which are more severe in non-vaccinated than the vaccinated broiler chickens, suggesting the protective effect of vaccination. Similar results were observed by (Rehman et al., 2018), recording oxidative stress in the brain and plasma of chickens infected with virulent NDV. This was evidenced by the elevation of MDA and nitric oxide concentrations, subsequently with a diminution of antioxidant enzymatic activities and GSH level. Also, Afsar et al. (2018) showed that broiler chickens challenged with NDV exhibited a higher increase in the serum MDA and a decline in total antioxidant activity. Dietary administration of LO and/or GO prevented oxidative stress by enhancing the antioxidants and attenuating lipid peroxidation. In the same line, inhibition of lipid peroxidation and oxidative stress by using LO was attributed to preventing the damaging impact of free radicals on biomolecules (Ojo et al., 2006).
Ellagic acid, a central LO and GO phenolic compound, enhanced the antioxidant status in heat-stressed birds via modulating Nrf2 mRNA expression (Yang et al., 2022).
Spleen interleukin-10 and interferon gamma expression
The mRNA expression of IL-10 in spleen tissue from non-vaccinated broiler chickens was significantly upregulated (p ≤ 0.05) in G2 (∼1.8-fold) compared to the control group. Supplementation with LO, GO, or their combination, either prophylactically or post-challenge, significantly increased IL-10 mRNA transcription (∼2.5-fold) compared to the control group but showed no statistically significant difference compared to G2 (Fig. 1A). Similarly, in vaccinated broiler chickens, the mRNA expression of IL-10 in G2 was significantly upregulated (∼1.7-fold) compared to the control group. However, supplementation with LO and GO, whether administered prophylactically or therapeutically, resulted in an insignificant upregulation of IL-10 transcription compared to G2. In contrast, therapeutic supplementation with LO and GO slightly downregulated IL-10 mRNA expression compared to G2, although this change was not statistically significant (Fig. 1B). While trends in IL-10 expression were observed, none of the results were statistically significant compared to the positive control (G2). Therefore, it is impossible to conclusively attribute a positive effect on IL-10 transcription to LO and GO supplementation under the conditions of this study.
Fig. 1. Fold change of IL-10 mRNA expression in spleen tissue. A; non-vaccinated broilers, B; vaccinated broilers, G1; Control negative, G2; Control positive, G3; Preventive lemon grass oil, G4, Preventive geranium oil, G5; Preventive lemon grass and geranium oil, G6; Treated lemon grass oil, G7; Treated geranium oil, G8; Treated lemon grass and geranium oil. Columns with different small letters are significantly different at P ≤ 0.05. One-way analysis of variance (ANOVA) with Tukey’s multiple comparison tests.
This study highlights the immune-modulating effects of LO and GO during NDV challenge, evidenced by upregulated IL-10 (Fig. 1) and downregulated IFN-γ expression (Fig. 2). IL-10, an anti-inflammatory cytokine, reduces tissue damage but may support viral persistence by decreasing apoptotic and pro-inflammatory cytokine production (Arendt et al., 2019). The upregulation of IL-10 in NDV-challenged and LO/GO-supplemented groups raises concerns about whether these oils enhance viral infectivity or modulate immune responses positively. Downregulation of IFN-γ, crucial for antiviral defense, suggests a shift from Th1-mediated immunity to a Th2-dominated anti-inflammatory response, potentially weakening antiviral defenses (Susta et al., 2013). In this study, spleen IFN-γ mRNA was highly upregulated in G2 (∼4-fold vs. control) but reduced in LO/GO-supplemented groups (∼2.5-fold vs. G2). In contrast, vaccinated groups showed lower IFN-γ levels (∼1.45-fold) in pretreated and treated groups (Fig. 2A, 2B).
Fig. 2. Fold change of in IFN-γ mRNA expression in spleen tissue. A; non-vaccinated broilers, B; vaccinated broilers, G1; Control negative, G2; Control positive, G3; Preventive lemon grass oil, G4, Preventive geranium oil, G5; Preventive lemon grass and geranium oil, G6; Treated lemon grass oil, G7; Treated geranium oil, G8; Treated lemon grass and geranium oil. Columns with different small letters significantly differ at P ≤ 0.05. One-way analysis of variance (ANOVA) with Tukey’s multiple comparison tests.
The bioactive compounds in LO and GO, such as limonene, citral, and citronellol, contribute to their anti-inflammatory effects by inhibiting IL-1β and IL-6 production (Bachiega and Sforcin, 2011; de Souza et al., 2019). LO also exhibits antiviral activity against influenza and SARS-CoV-2 (Chiamenti et al., 2019). While dietary quercetin improves immunity by downregulating pro-inflammatory cytokines and upregulating IL-10 (Ibrahim et al., 2021), the observed suppression of IFN-γ in LO/GO-supplemented groups suggests a need for further investigation into whether these oils compromise antiviral defenses or beneficially modulate immunity.
In the non-vaccinated broiler chickens, on the 28th day (the day before the challenge), the Ab titer to NDV did not differ among groups except for the preventive GO group (G4), which showed the highest titer (Log2 2.8). The Ab titer was increased in all experimental groups except control one at 7 days post-challenge when compared to the titer in the same groups on the 28th day (day before the challenge), where the titer of G2 was significantly (p ≤ 0.05) higher than that in the control group but not differed from preventive groups. Interestingly, post-challenge supplemented with LO and GO mainly had higher Ab titer (∼ Log2 4.5) than G2 and protected groups (Fig. 3A).
Fig. 3. HI titer (log2) to NDV before and after the challenge. A; non-vaccinated broilers, B; vaccinated broilers, G1; Control negative, G2; Control positive, G3; Preventive lemon grass oil, G4, Preventive geranium oil, G5; Preventive lemon grass and geranium oil, G6; Treated lemon grass oil, G7; Treated geranium oil, G8; Treated lemon grass and geranium oil. Columns with different small letters significantly differ at P ≤ 0.05. One-way analysis of variance (ANOVA) with Tukey’s multiple comparison tests.
The Ab titer to NDV in the vaccinated broiler chickens at 28th did not differ among all groups. Seven days post-challenge, the Ab titer significantly increased in G2 (Log2 9.7) compared to the control group (Log2 4.5). Prevention and treatment with LO and GO alone or in combination insignificantly increased Ab titer with the greater titer (Log2 10.7) was observed in LO, either protected or post-challenge supplemented (Fig. 3B). Our results regarding antibody titers are consistent with the findings of (Sira et al., 2018), who reported enhanced immune responses and increased antibody titers in both non-vaccinated and vaccinated native chickens following the NDV challenge. However, in our study, while increased antibody titers were observed in vaccinated groups supplemented with LO and GO (Fig. 3B, G3-G6, and G8), the differences were not statistically significant compared to the vaccinated control group (G2). This indicates that while LO and GO may contribute to immune modulation, their impact on antibody production in vaccinated chickens under the conditions of this study was not pronounced enough to achieve statistical significance. These findings suggest further research to elucidate the role of LO and GO in influencing the humoral immune response in vaccinated birds. The immunomodulatory activity of LO may be explained by the activation and proliferation of lymphocytes or by provoking the number of macrophages and T-helper lymphocytes (Haque et al., 2018). Also, quercetin, a major flavonoid of LO and GO, has immunostimulant and anti-inflammatory effects owed to enhanced IgG production in the birds (Hager-Theodorides et al., 2014).
Growth performance
There was no statistical difference in final body weight between the supplemented groups (G3-G8) and the controls (G1 and G2), suggesting that the essential oils did not have a statistically significant growth-promoting effect. In non-vaccinated broiler chickens, the final body weight of G2 (positive control) was significantly decreased compared to the negative control (G1). Supplementation with LO and GO, either prophylactically or post-challenge, resulted in an insignificant increase in final body weight compared to G2. Among vaccinated broiler chickens, no significant differences in final body weight were observed across all experimental groups (Table 9).
Table 9. Preventive and therapeutic effect of LO and GO alone or in combination on final body weight in non-vaccinated and vaccinated broilers challenged with NDV.
| Empty Cell | G1 | G2 | G3 | G4 | G5 | G6 | G7 | G8 | P-Value |
|---|---|---|---|---|---|---|---|---|---|
| Non-vaccinated broilers | |||||||||
| Final body weight (g) | 2277.50± 46.39a |
1853.33± 75.33b |
2168.33± 82.55ab |
2092.50± 77.33ab |
1955.42± 98.07ab |
2062.50± 104.31ab |
2191.25± 112.07ab |
1965.45± 118.65ab |
0.024 |
| Vaccinated broilers | |||||||||
| Final body weight (g) | 2406.67± 41.12 |
2369.09± 71.11 |
2376.67± 58.69 |
2367.92± 48.20 |
2362.92± 50.85 |
2349.00± 75.26 |
2425.42± 66.13 |
2350.45± 90.08 |
0.243 |
Values are expressed as Means ± SE.a–b-c Mean values within the same row with different superscript letters are a statistically significant difference. . One-ways analysis of variance (ANOVA) with Tukey’s multiple comparison tests.
2G1; Non-Vaccinated-Control, G2; Vaccinated-Control, G3; Non-vaccinated-LO-Prophylactic, G4, Non-vaccinated-GO-Prophylactic, G5; Non-vaccinated-LO+GO-Prophylactic, G6; Non-vaccinated-LO-Therapeutic, G7; Non-vaccinated-GO-Therapeutic, G8; Non-vaccinated-LO+GO-Therapeutic.
Although statistical significance was not achieved, the trend of improved body weight in LO and/or GO-supplemented broilers, mainly when used prophylactically, suggests a potential growth-promoting effect. This observation aligns with previous studies demonstrating that dietary inclusion of LO improved broilers’ body weight gain and feed conversion rates. These trends warrant further investigation with larger sample sizes to confirm the potential benefits of essential oils in promoting growth.
To reconcile the biochemical benefits of LO and GO with the increased mortality observed, future research should focus on Dose Optimization, which identifies the optimal concentrations of LO and GO to maximize their immunomodulatory and antioxidant effects while minimizing adverse outcomes. Timing of Administration: Investigating whether prophylactic or therapeutic supplementation has differential impacts on NDV-challenged birds. Long-Term Safety: Evaluating the cumulative effects of LO and GO on immune dynamics and viral interactions over extended periods. Molecular Studies: Employing transcriptomics and proteomics to uncover the pathways influenced by LO and GO under NDV challenge conditions. Despite the observed challenges, LO and GO hold promise as natural immunomodulators and growth promoters. To optimize their application, evidence-based protocols must guide their integration into poultry management programs. These findings contribute to the global effort to reduce antibiotic dependency in poultry farming while emphasizing the importance of balancing efficacy and safety.
Conclusions and applications
This study highlights the dual roles of LO and GO as prophylactic and therapeutic agents in managing NDV challenges in poultry. Supplementation improved antioxidant status, modulated cytokine expression, and enhanced liver and kidney function. However, the unexpected increase in mortality suggests a need for further investigation into the oils’ interactions with viral replication and immune responses. Future research should optimize dosing, timing, and application protocols and incorporate SPF chickens to evaluate direct effects under controlled conditions. Advanced techniques, such as transcriptomics and proteomics, could provide deeper insights into the molecular mechanisms of these oils. While promising, using LO and GO must be guided by evidence-based practices to ensure safety and efficacy.
Source: Science Direct – Journal of Applied Poultry Research
