
Summary
Description of problem
Materials and methods
Table 1. Definition and description of the treatments in the study.
| Treatment | Description |
|---|---|
| Ventilation Shutdown plus Heat (VSDH) | Ventilation is shut off and all inlets and exhausts are sealed and heat is supplemented |
| Ventilation Shutdown plus Heat and Relative Humidity (VSDHRh) | Ventilation is shut off and all inlets and exhausts are sealed and heat and humidity is supplemented with a target of ∼99 % |
| Ventilation Shutdown plus Carbon dioxide (VSDCO2) | Ventilation is shut off, all inlets and exhausts are sealed and Carbon dioxide (CO2) is supplemented to ∼30 % |
Table 2. Description of observed behaviors and analyzed reported every two-minutes in P11.
| Behaviors | Description |
|---|---|
| Conscious | |
| Headshake | Rapid shaking or lateral movement of the head |
| Mandibulation/Panting | Repetitive tasting movement with bill and Deeper than normal expiration through open mouth. |
| Standing | Partially flexed hip, knee, and jock joints. |
| Wing Flapping | A bout of continuous, rapid wing flapping |
| Crouch | Leg joints are flexed maximally |
| Jump | Spring from the floor with propulsive force derived from the leg. |
| Unconscious (<0.01 mV EEG) | |
| Respiratory Disruption/Gaping | Deep, open bill with prolonged open bill gaping, or both, combined with apparent inhalation attempts. |
| Loss of Posture | Loss of balance or posture, or both (lateral recumbency) |
| Cessation of Movement | Exclusion of any bird movement due to loss of posture, respiration, mouth gaping, specific colonic and tonic convulsions, stiffening, and feather trembling. This was the determination of bird death. |
- 1
-
Behaviors adapted from Krish, 2018.
Table 3. Calculated removal time in minutes for Phase 2 for each treatment. Sequence is Baseline = 0, 25 is 25 % to TOD, 50 is 50 % to TOD, 75 is 75 % to TOD, and 100 % is TOD.
| Empty Cell | 0 | 25 | 50 | 75 | 100 |
|---|---|---|---|---|---|
| Treatment1 | Minutes | ||||
| VSDH | – | 16 | 32 | 48 | 64 |
| VSDHRh | – | 15 | 30 | 45 | 60 |
| VSDCO2 | – | 5 | 10 | 15 | 20 |
- 1
-
VSDH = ventilation shutdown plus heat; VSDHRh = ventilation shutdown plus heat and relative humidity; VSDCO2 = ventilation shutdown plus carbon dioxide.
Table 4. Genes and their genetic sequences (forward and reverse) utilized for gene expression.
| Gene | Primer | Directional Sequence | Sequence |
|---|---|---|---|
| Beta Actin | b-Actin | Forward | GTCCACCTTCCAGCAGATGT |
| Reverse | ATAAAGCCATGCCAATCTCG | ||
| Heat Shock Protein | HSP70 | Forward | GCGGAGCGAGTGGCTGACTG |
| Reverse | CGGTTCCCCTGGTCGTTGGC |
Statistical analysis
Results and discussion
Phase 1
Table 5. Broiler bodyweight and start and end temperature, relative humidity, and CO2 levels during P1 for each treatment.
| Treatment1 | Broiler Body Weight (kg) | Start Chamber Temperature (°C) | Start Chamber Relative Humidity ( %) | Start CO2 ( %) | End Chamber Temperature (°C) | End Chamber Relative Humidity ( %) | End CO2 ( %) |
|---|---|---|---|---|---|---|---|
| VSDH | 2.39 | 29.58a | 35.05b | 0.31 | 38.81a | 85.55a | 2.40b |
| VSDHRh | 2.41 | 30.00a | 33.08b | 0.34 | 41.78a | 82.70a | 1.89b |
| VSDCO2 | 2.36 | 26.39b | 43.43a | 0.28 | 27.84b | 65.25b | 16.85a |
| SEM | 0.15 | 0.12 | 1.47 | 0.09 | 2.12 | 2.43 | 1.08 |
| P-value | 0.9734 | <0.0001 | 0.0017 | 0.8745 | 0.0029 | 0.0005 | <0.0001 |
- 1
-
VSDH = ventilation shutdown plus heat; VSDHRh = ventilation shutdown plus heat and relative humidity; VSDCO2 = ventilation shutdown plus carbon dioxide.
Table 6. Broiler time of death and pre and post core body temperatures for each treatment.
| Treatment1 | Core Body Temperature (°C) | TOD (minutes) | |
|---|---|---|---|
| Empty Cell | Pre | Post | Empty Cell |
| VSDH | 38.93 | 45.55a | 63.75a |
| VSDHRh | 38.52 | 45.75a | 58.25a |
| VSDCO2 | 39.70 | 41.80b | 21.25b |
| SEM | 1.15 | 0.39 | 3.71 |
| P-value | 0.7671 | <0.0001 | <0.0001 |
- 1
-
VSDH = ventilation shutdown plus heat; VSDHRh = ventilation shutdown plus heat and relative humidity; VSDCO2 = ventilation shutdown plus carbon dioxide.
Fig. 1. Composite electroencephalogram (EEG) graphs of broilers close to time of death (TOD) in chambers during P1 for the three treatments. VSDH = ventilation shutdown plus heat; VSDHRh = ventilation shutdown plus heat and relative humidity; VSDCO2 = ventilation shutdown plus carbon dioxide.
Fig. 2. Integrated area under the EEG graph calculated from the transformed composite EEGs for VSDH, VSDHRh, and VSDCO2 through TOD using the trapezoidal method. VSDH = ventilation shutdown plus heat; VSDHRh = ventilation shutdown plus heat and relative humidity; VSDCO2 = ventilation shutdown plus carbon dioxide.
Fig. 3. Frequency of voluntary and involuntary behavioral responses of broilers undergoing VSDH, VSDHRh, and VSDCO2 through to time of death in correlation with EEG signals. VSDH = ventilation shutdown plus heat; VSDHRh = ventilation shutdown plus heat and relative humidity; VSDCO2 = ventilation shutdown plus carbon dioxide.
Table 7. Strength of EEG waves for each treatment group.
| Treatment1 | Percent EEG time within each mV range | |||
|---|---|---|---|---|
| Empty Cell | 0-0.01 mV ( %) | 0.01-0.03 mV ( %) | 0.03-0.05 mV ( %) | >0.05 mV ( %) |
| VSDH | 73.28 | 16.14 | 4.18 | 6.41 |
| VSDHRh | 84.11 | 7.08 | 3.18 | 5.64 |
| VSDCO2 | 84.11 | 8.27 | 2.03 | 5.59 |
| SEM | 12.69 | 6.00 | 2.28 | 4.68 |
| P-value | 0.7894 | 0.5340 | 0.8056 | 0.9905 |
- 1
-
VSDH = ventilation shutdown plus heat; VSDHRh = ventilation shutdown plus heat and relative humidity; VSDCO2 = ventilation shutdown plus carbon dioxide.
Table 8. Pearson Linear Correlation Coefficients associated with Behavior Observations as they relate to the electroencephalogram (EEG) waves.
| Treatment1 | Conscious2 | Confidence Interval | Empty Cell | Behaviors | |
|---|---|---|---|---|---|
| Empty Cell | >0.01 mV | Lower 95 % | Upper 95 % | P–Value | N= |
| VSDH | 0.005 | -0.162 | 0.172 | 0.9505 | 138 |
| VSDHRh | -0.138 | -0.308 | 0.040 | 0.1268 | 123 |
| VSDCO2 | 0.006 | -0.282 | 0.293 | 0.9680 | 47 |
| Treatment | Unconscious3 | Confidence Interval | Empty Cell | Behaviors | |
|---|---|---|---|---|---|
| Empty Cell | <0.01 mV | Lower 95 % | Upper 95 % | P–Value | N= |
| VSDH | 0.038 | -0.130 | 0.204 | 0.6578 | 138 |
| VSDHRh | 0.117 | -0.012 | 0.288 | 0.1982 | 123 |
| VSDCO2 | -0.006 | -0.293 | 0.282 | 0.9676 | 47 |
- 1
-
VSDH = ventilation shutdown plus heat; VSDHRh = ventilation shutdown plus heat and relative humidity; VSDCO2 = ventilation shutdown plus carbon dioxide.
- 2
-
Conscious behavior were defined as voluntary behaviors.
- 3
-
Unconscious behaviors were defined as involuntary and were determined when the EEG readings dropped below 0.01 mV.
Table 9. Comparison of blood chemistry of broiler chickens depopulated using VSDH (Hyperthermic method), VSDHRh and VSDCO2 from P1.
| Treatment1 | VSDH | VSDHRh | VSDCO2 | SEM | P-value |
|---|---|---|---|---|---|
| pH | 6.94 | 7.08 | 7.05 | 0.03 | 0.1716 |
| pCO2 (mmHg) | 66.85b | 59.08b | 92.43a | 6.35 | 0.04 |
| pO2 (mmHg) | 47.00b | 42.50b | 70.50a | 5.67 | 0.02 |
| BEecf2(mmol/L) | -18.00b | -14.75b | -5.75a | 1.79 | 0.0015 |
| HCO3 (mmol/L) | 14.28b | 15.38b | 24.93a | 1.54 | <0.0001 |
| TCO23 (mmol/L) | 16.25b | 16.75b | 28.00a | 1.71 | <0.0001 |
| sO24 ( %) | 55.25b | 58.25ab | 79.00a | 4.38 | 0.0343 |
| Na (mmol/L) | 139.50b | 150.00a | 139.50b | 2.18 | 0.0469 |
| K (mmol/L) | 9.00 | 9.00 | 8.80 | 0.07 | 0.4053 |
| iCa5 (mmol/L) | 1.24b | 1.22b | 1.81a | 0.08 | <0.0001 |
| Glucose (mg/dL) | 338.50 | 300.00 | 275.75 | 22.87 | 0.5741 |
| Hct6 ( % PCV) | 20.25 | 20.75 | 17.00 | 0.96 | 0.2354 |
| Hb7 (g/dL) | 6.88 | 7.05 | 5.80 | 0.35 | 0.3642 |
- 1
-
VSDH = ventilation shutdown plus heat; VSDHRh = ventilation shutdown plus heat and relative humidity; VSDCO2 = ventilation shutdown plus carbon dioxide.
- 2
-
BEecf= base excess in the extracellular fluid.
- 3
-
TCO2=total Carbon dioxide.
- 4
-
sO2=blood oxygen saturation.
- 5
-
iCa=ionized calcium.
- 6
-
Hct=hematocrit.
- 7
-
Hb=Hemoglobin
Table 10. Effects of VSDH, VSDHRh, and VSDCO2 on broiler chicken corticosterone and heat shock protein 70 (HSP70) levels.
| Treatment1 | VSDH | VSDHRh | VSDCO2 | SEM | P-value |
|---|---|---|---|---|---|
| Corticosterone (ng/mL) | 0.11 | 0.10 | 0.12 | 0.002 | 0.07 |
| HSP70 (CT–1) | 1.23a | 0.98b | 0.90b | 0.06 | 0.0014 |
- 1
-
VSDH = ventilation shutdown plus heat; VSDHRh = ventilation shutdown plus heat and relative humidity; VSDCO2 = ventilation shutdown plus carbon dioxide.
Phase 2
Table 11. P2 blood chemistry of broiler chickens depopulated using VSDH (Hyperthermic method) using the TOD from P1 to evaluate changes.
| Treatment | VSDH1 | SEM | P-value | ||||
|---|---|---|---|---|---|---|---|
| Sequence2 | 0 | 25 | 50 | 75 | 100 | ||
| pH | 7.42 | 7.55 | 7.46 | 7.55 | 7.46 | 0.04 | 0.23 |
| pCO2 (mmHg) | 41.35 | 34.95 | 37.90 | 34.55 | 38.40 | 4.85 | 0.85 |
| pO2 (mmHg) | 66.50 | 53.00 | 59.50 | 63.50 | 46.00 | 13.04 | 0.80 |
| Beecf3 (mmol/L) | 2.00 | 7.50 | 3.50 | 3.00 | 0.50 | 2.44 | 0.43 |
| HCO3 (mmol/L) | 26.80 | 30.10 | 27.10 | 24.20 | 26.60 | 2.35 | 0.58 |
| TCO24 (mmol/L) | 28.00 | 31.00 | 28.00 | 27.50 | 26.00 | 2.54 | 0.73 |
| sO25 ( %) | 91.00 | 90.50 | 93.50 | 84.50 | 82.50 | 6.07 | 0.68 |
| Na (mmol/L) | 140.50 | 140.00 | 142.50 | 153.00 | 141.00 | 5.94 | 0.55 |
| K (mmol/L) | 4.95 | 4.80 | 5.15 | 4.80 | 6.05 | 0.84 | 0.81 |
| iCa6 (mmol/L) | 1.96 | 2.22 | 2.16 | 1.52 | 1.45 | 0.36 | 0.49 |
| Glucose (mg/dL) | 218.00 | 221.50 | 224.00 | 228.00 | 228.00 | 11.57 | 0.96 |
| Hct7 ( % PCV) | 23.00 | 25.50 | 25.00 | 25.50 | 24.00 | 2.95 | 0.96 |
| Hb8 (g/dL) | 7.85 | 8.65 | 8.50 | 8.20 | 7.80 | 1.00 | 0.96 |
- 1
-
VSDH = ventilation shutdown plus heat.
- 2
-
Sequence is Baseline = 0, 25 is 25 % to TOD, 50 is 50 % to TOD, 75 is 75 % to TOD, and 100 is TOD.
- 3
-
BEecf= base excess in the extracellular fluid.
- 4
-
TCO2=total Carbon dioxide.
- 5
-
sO2=blood oxygen saturation.
- 6
-
iCa=ionized calcium.
- 7
-
Hct=hematocrit.
- 8
-
Hb=Hemoglobin
Table 12. P2 blood chemistry of broiler chickens depopulated using VSDHRh (Hyperthermic method) using the TOD from P1 to evaluate changes.
| Treatment | VSDHRh1 | SEM | P-value | ||||
|---|---|---|---|---|---|---|---|
| Sequence2 | 0 | 25 | 50 | 75 | 100 | ||
| pH | 7.41 | 7.54 | 7.55 | 7.58 | 7.47 | 0.05 | 0.24 |
| pCO2 (mmHg) | 45.25 | 34.45 | 31.90 | 29.70 | 32.90 | 4.09 | 0.20 |
| pO2 (mmHg) | 54.50 | 37.50 | 51.50 | 48.50 | 42.50 | 8.82 | 0.68 |
| Beecf3 (mmol/L) | 4.00 | 7.50 | 5.50 | 6.00 | 0.00 | 2.66 | 0.43 |
| HCO3 (mmol/L) | 28.70 | 29.65 | 27.75 | 27.65 | 23.60 | 2.16 | 0.43 |
| TCO24 (mmol/L) | 30.00 | 30.50 | 29.00 | 28.50 | 24.50 | 2.40 | 0.49 |
| sO25( %) | 82.00 | 78.50 | 90.50 | 90.00 | 81.50 | 5.32 | 0.47 |
| Na (mmol/L) | 148.50 | 151.00 | 155.50 | 147.50 | 149.00 | 3.09 | 0.46 |
| K (mmol/L) | 5.80 | 5.35 | 5.70 | 5.55 | 5.75 | 0.48 | 0.95 |
| iCa6 (mmol/L) | 1.43 | 1.42 | 1.50 | 1.52 | 1.36 | 0.19 | 0.97 |
| Glucose (mg/dL) | 232.00 | 221.50 | 237.50 | 251.00 | 234.00 | 8.34 | 0.30 |
| Hct7 ( % PCV) | 22.00 | 21.00 | 21.00 | 19.50 | 23.00 | 1.43 | 0.56 |
| Hb8 (g/dL) | 7.50 | 7.15 | 7.15 | 6.65 | 7.85 | 0.49 | 0.55 |
- 1
-
VSDRhH = ventilation shutdown plus heat and relative humidity.
- 2
-
Sequence is Baseline = 0, 25 is 25 % to TOD, 50 is 50 % to TOD, 75 is 75 % to TOD, and 100 is TOD.
- 3
-
BEecf= base excess in the extracellular fluid.
- 4
-
TCO2=total Carbon dioxide.
- 5
-
sO2=blood oxygen saturation.
- 6
-
iCa=ionized calcium.
- 7
-
Hct=hematocrit.
- 8
-
Hb=Hemoglobin
Table 13. P2 blood chemistry of broiler chickens depopulated using VSDHCO2 (Hyperthermic method) using the TOD from P1 to evaluate changes.
| Treatment | VSDCO21 | SEM | P-value | ||||
|---|---|---|---|---|---|---|---|
| Sequence2 | 0 | 25 | 50 | 75 | 100 | ||
| pH | 7.38 | 7.28 | 7.28 | 7.23 | 7.27 | 0.05 | 0.39 |
| pCO2 (mmHg) | 47.90 | 61.80 | 54.70 | 66.30 | 61.70 | 8.47 | 0.61 |
| pO2 (mmHg) | 42.50 | 57.50 | 54.00 | 58.00 | 54.00 | 7.87 | 0.66 |
| Beecf3 (mmol/L) | 3.50 | 2.00 | -1.00 | 0.00 | 1.50 | 3.05 | 0.85 |
| HCO3 (mmol/L) | 28.55 | 28.75 | 25.65 | 27.45 | 28.55 | 2.73 | 0.91 |
| TCO24 (mmol/L) | 30.00 | 31.00 | 27.50 | 29.50 | 30.50 | 2.89 | 0.92 |
| sO25 ( %) | 76.50 | 84.0 | 81.00 | 83.00 | 81.50 | 4.53 | 0.80 |
| Na (mmol/L) | 154.50 | 145.50 | 146.00 | 153.50 | 143.00 | 4.31 | 0.35 |
| K (mmol/L) | 6.00 | 6.60 | 6.60 | 5.80 | 6.15 | 0.32 | 0.39 |
| iCa6 (mmol/L) | 1.51 | 1.39 | 1.52 | 1.66 | 1.81 | 0.18 | 0.56 |
| Glucose (mg/dL) | 219.00 | 246.50 | 239.00 | 243.50 | 259.00 | 19.21 | 0.69 |
| Hct7 ( % PCV) | 22.50 | 22.50 | 24.50 | 22.50 | 24.00 | 3.03 | 0.98 |
| Hb8 (g/dL) | 7.65 | 8.15 | 8.35 | 7.65 | 8.20 | 1.07 | 0.98 |
- 1
-
VSDCO2= ventilation shutdown plus carbon dioxide.
- 2
-
Sequence is Baseline = 0, 25 is 25 % to TOD, 50 is 50 % to TOD, 75 is 75 % to TOD, and 100 is TOD.
- 3
-
BEecf= base excess in the extracellular fluid.
- 4
-
TCO2=total Carbon dioxide.
- 5
-
sO2=blood oxygen saturation.
- 6
-
iCa=ionized calcium.
- 7
-
Hct=hematocrit.
- 8
-
Hb=Hemoglobin
Table 14. P2, Corticosterone and HSP70 levels of broiler chickens depopulated using VSDH, VSDHRh, or VSDCO2 using the average TOD from P1 to evaluate changes.
| Treatment1 | Sequence2 | 0 | 25 | 50 | 75 | 100 | SEM | P-value |
|---|---|---|---|---|---|---|---|---|
| VSDH | Corticosterone (ng/mL) | 0.18 | 0.18 | 0.19 | 0.27 | 0.19 | 0.06 | 0.82 |
| HSP70 (CT–1) | 0.84 | 0.89 | 0.86 | 0.99 | 1.16 | 0.06 | 0.06 | |
| VSDHRh | Corticosterone (ng/mL) | 0.18 | 0.14 | 0.20 | 0.22 | 0.20 | 0.05 | 0.20 |
| HSP70 (CT–1) | 0.88 | 0.95 | 0.86 | 1.07 | 1.06 | 0.06 | 0.12 | |
| VSDCO2 | Corticosterone (ng/mL) | 0.17 | 0.20 | 0.24 | 0.23 | 0.20 | 0.06 | 0.57 |
| HSP70 (CT–1) | 1.10 | 0.67 | 0.87 | 0.79 | 0.88 | 0.13 | 0.32 |
- 1
-
VSDH = ventilation shutdown plus heat.
- 2
-
Sequence is Baseline = 0, 25 is 25 % to TOD, 50 is 50 % to TOD, 75 is 75 % to TOD, and 100 is TOD.
Conclusions and applications
- 1.
There were no significant differences between conscious and unconscious behaviors at the lower or upper EEG ranges. However, around the midway point of each treatment there was a noticeable shift toward unconscious behaviors.
- 2.
In the VSDCO2 treatment, the influence of a high CO2 environment appeared to influence the pH, pCO2, and pO2 more than in the VSDH or VSDHRh treatments.
- 3.
The results from P2 appear to indicate similarity among these methods as effective broiler flock depopulation methods with respect to their effects on each parameter measured over time.
- 4.
Based on the results above, VSDHRh may be a viable alternative method for broiler depopulation considering how similar it is to VSDH. However, it did have reduced HSP70 levels compared to VSDH, but more research needs to be conducted to fully understand how this treatment works in a non-environmentally controlled setting.
Source: Science Direct







